|
ATCC
atcc 12916 Atcc 12916, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atcc 12916/product/ATCC Average 94 stars, based on 1 article reviews
atcc 12916 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
ATCC
cpe gene ![]() Cpe Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpe gene/product/ATCC Average 99 stars, based on 1 article reviews
cpe gene - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
cpe positive type a strains ![]() Cpe Positive Type A Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpe positive type a strains/product/ATCC Average 95 stars, based on 1 article reviews
cpe positive type a strains - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
ATCC
respiratory syncytial virus type a ![]() Respiratory Syncytial Virus Type A, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/respiratory syncytial virus type a/product/ATCC Average 92 stars, based on 1 article reviews
respiratory syncytial virus type a - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
ATCC
c novyi type a strain jcm1406t ![]() C Novyi Type A Strain Jcm1406t, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c novyi type a strain jcm1406t/product/ATCC Average 94 stars, based on 1 article reviews
c novyi type a strain jcm1406t - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
ATCC
atcc control strains ![]() Atcc Control Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atcc control strains/product/ATCC Average 99 stars, based on 1 article reviews
atcc control strains - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Siemens AG
siemens typea ![]() Siemens Typea, supplied by Siemens AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/siemens typea/product/Siemens AG Average 90 stars, based on 1 article reviews
siemens typea - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Tokyo Chemical Industry
qcl-typea ![]() Qcl Typea, supplied by Tokyo Chemical Industry, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qcl-typea/product/Tokyo Chemical Industry Average 90 stars, based on 1 article reviews
qcl-typea - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ImmunoGen Inc
vlps ![]() Vlps, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vlps/product/ImmunoGen Inc Average 90 stars, based on 1 article reviews
vlps - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Matsunami Glass
mas-gp typea-coated slides ![]() Mas Gp Typea Coated Slides, supplied by Matsunami Glass, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mas-gp typea-coated slides/product/Matsunami Glass Average 90 stars, based on 1 article reviews
mas-gp typea-coated slides - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Nihon Gene Research Laboratories
typea/m264r2 acaaagcgtctacgctgcag ![]() Typea/M264r2 Acaaagcgtctacgctgcag, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/typea/m264r2 acaaagcgtctacgctgcag/product/Nihon Gene Research Laboratories Average 90 stars, based on 1 article reviews
typea/m264r2 acaaagcgtctacgctgcag - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Allergan
botulinum toxin typea ![]() Botulinum Toxin Typea, supplied by Allergan, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/botulinum toxin typea/product/Allergan Average 90 stars, based on 1 article reviews
botulinum toxin typea - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America
doi: 10.1128/JCM.39.3.883-888.2001
Figure Lengend Snippet: Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and CPE. Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), and F4969 (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the
Techniques: Multiplex Assay, Migration, Derivative Assay
Journal:
Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America
doi: 10.1128/JCM.39.3.883-888.2001
Figure Lengend Snippet: RFLP Southern blot analysis of NruI-digested DNA from North American human GI disease isolates. Southern blots were probed with a 639-bp DIG-labeled cpe-specific probe. Control isolates shown include 10239 (NCTC10239; a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. Molecular sizes of DNA markers are given to the left of the blot.
Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the
Techniques: Southern Blot, Labeling, Plasmid Preparation
Journal:
Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America
doi: 10.1128/JCM.39.3.883-888.2001
Figure Lengend Snippet: PFGE Southern blot analysis of selected North American human GI disease isolates. PFGE and Southern hybridization analysis of undigested (UC) and I-CeuI cut (C) DNA from selected isolates. Blots are probed with a cpe-specific probe. Control isolates shown include 10239 (NCTC10239; a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. The pulsed-field gel was calibrated with Lambda DNA markers, whose migration is shown at the left of the blot.
Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the
Techniques: Southern Blot, Hybridization, Plasmid Preparation, Pulsed-Field Gel, Lambda DNA Preparation, Migration
Journal:
Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America
doi: 10.1128/JCM.39.3.883-888.2001
Figure Lengend Snippet: Western Blot analysis of CPE expression by selected North American human GI disease isolates. The expression of CPE by sporulating cultures of control and disease isolates of C. perfringens was evaluated using a CPE-specific Western immunoblot procedure. Isolates were grown in sporulation media as described in the Materials and Methods and then sonicated. An aliquot (40 μl) of each sonicated sporulating culture lysate was then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by immunoblotting with CPE antibodies. The blot was developed for chemiluminescence detection to identify immunoreactive species. Results for control isolates shown include 10239 (NCTC10239, a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Results for representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. Molecular mass markers are shown at left; the arrow at right indicates the migration of purified CPE.
Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the
Techniques: Western Blot, Expressing, Sonication, Polyacrylamide Gel Electrophoresis, Plasmid Preparation, Migration, Purification