cpe positive type a strains Search Results


94
ATCC atcc 12916
Atcc 12916, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atcc 12916/product/ATCC
Average 94 stars, based on 1 article reviews
atcc 12916 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

99
ATCC cpe gene
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Cpe Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpe gene/product/ATCC
Average 99 stars, based on 1 article reviews
cpe gene - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

95
ATCC cpe positive type a strains
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Cpe Positive Type A Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpe positive type a strains/product/ATCC
Average 95 stars, based on 1 article reviews
cpe positive type a strains - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

92
ATCC respiratory syncytial virus type a
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Respiratory Syncytial Virus Type A, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/respiratory syncytial virus type a/product/ATCC
Average 92 stars, based on 1 article reviews
respiratory syncytial virus type a - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

94
ATCC c novyi type a strain jcm1406t
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
C Novyi Type A Strain Jcm1406t, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c novyi type a strain jcm1406t/product/ATCC
Average 94 stars, based on 1 article reviews
c novyi type a strain jcm1406t - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

99
ATCC atcc control strains
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Atcc Control Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atcc control strains/product/ATCC
Average 99 stars, based on 1 article reviews
atcc control strains - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

90
Siemens AG siemens typea
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Siemens Typea, supplied by Siemens AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/siemens typea/product/Siemens AG
Average 90 stars, based on 1 article reviews
siemens typea - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Tokyo Chemical Industry qcl-typea
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Qcl Typea, supplied by Tokyo Chemical Industry, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qcl-typea/product/Tokyo Chemical Industry
Average 90 stars, based on 1 article reviews
qcl-typea - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
ImmunoGen Inc vlps
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Vlps, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vlps/product/ImmunoGen Inc
Average 90 stars, based on 1 article reviews
vlps - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Matsunami Glass mas-gp typea-coated slides
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Mas Gp Typea Coated Slides, supplied by Matsunami Glass, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mas-gp typea-coated slides/product/Matsunami Glass
Average 90 stars, based on 1 article reviews
mas-gp typea-coated slides - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Nihon Gene Research Laboratories typea/m264r2 acaaagcgtctacgctgcag
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Typea/M264r2 Acaaagcgtctacgctgcag, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/typea/m264r2 acaaagcgtctacgctgcag/product/Nihon Gene Research Laboratories
Average 90 stars, based on 1 article reviews
typea/m264r2 acaaagcgtctacgctgcag - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Allergan botulinum toxin typea
Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and <t>CPE.</t> Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), <t>and</t> <t>F4969</t> (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.
Botulinum Toxin Typea, supplied by Allergan, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/botulinum toxin typea/product/Allergan
Average 90 stars, based on 1 article reviews
botulinum toxin typea - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and CPE. Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), and F4969 (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.

Journal:

Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America

doi: 10.1128/JCM.39.3.883-888.2001

Figure Lengend Snippet: Multiplex PCR analysis of North American human GI disease isolates. Representative results shown are for multiplex PCR using primers designed to amplify genes encoding each “typing” toxin and CPE. Migration of PCR products derived from each toxin gene are indicated on the left. As denoted on the figure by the letter shown in parentheses to their right, control typing strains used include NCTC8533 (type B), CN5383 (type C), PS52 (type D), 853 (type E), ATCC 3624 (cpe lacking, type A), and F4969 (cpe-positive, type A). Representative North American human GI disease isolates shown include 537-5 and 538-1 (food poisoning isolates) and T34058 and W30554 (AAD isolates). Molecular sizes of DNA markers are noted on the right of the figure.

Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the cpe gene on a plasmid ( 8 ); NCTC10239, a type A strain carrying a chromosomal cpe gene ( 8 ); ATCC 3624, a cpe -negative type A isolate ( 10 ); NCTC8533, a cpe -lacking, type B isolate (provided by Richard Titball); CN5383, a cpe -negative type C isolate ( 10 ); PS52, a cpe -negative type D isolate (provided by Ronald Labbe); and 853, a type E isolate carrying silent cpe sequences ( 1 ).

Techniques: Multiplex Assay, Migration, Derivative Assay

RFLP Southern blot analysis of NruI-digested DNA from North American human GI disease isolates. Southern blots were probed with a 639-bp DIG-labeled cpe-specific probe. Control isolates shown include 10239 (NCTC10239; a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. Molecular sizes of DNA markers are given to the left of the blot.

Journal:

Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America

doi: 10.1128/JCM.39.3.883-888.2001

Figure Lengend Snippet: RFLP Southern blot analysis of NruI-digested DNA from North American human GI disease isolates. Southern blots were probed with a 639-bp DIG-labeled cpe-specific probe. Control isolates shown include 10239 (NCTC10239; a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. Molecular sizes of DNA markers are given to the left of the blot.

Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the cpe gene on a plasmid ( 8 ); NCTC10239, a type A strain carrying a chromosomal cpe gene ( 8 ); ATCC 3624, a cpe -negative type A isolate ( 10 ); NCTC8533, a cpe -lacking, type B isolate (provided by Richard Titball); CN5383, a cpe -negative type C isolate ( 10 ); PS52, a cpe -negative type D isolate (provided by Ronald Labbe); and 853, a type E isolate carrying silent cpe sequences ( 1 ).

Techniques: Southern Blot, Labeling, Plasmid Preparation

PFGE Southern blot analysis of selected North American human GI disease isolates. PFGE and Southern hybridization analysis of undigested (UC) and I-CeuI cut (C) DNA from selected isolates. Blots are probed with a cpe-specific probe. Control isolates shown include 10239 (NCTC10239; a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. The pulsed-field gel was calibrated with Lambda DNA markers, whose migration is shown at the left of the blot.

Journal:

Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America

doi: 10.1128/JCM.39.3.883-888.2001

Figure Lengend Snippet: PFGE Southern blot analysis of selected North American human GI disease isolates. PFGE and Southern hybridization analysis of undigested (UC) and I-CeuI cut (C) DNA from selected isolates. Blots are probed with a cpe-specific probe. Control isolates shown include 10239 (NCTC10239; a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. The pulsed-field gel was calibrated with Lambda DNA markers, whose migration is shown at the left of the blot.

Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the cpe gene on a plasmid ( 8 ); NCTC10239, a type A strain carrying a chromosomal cpe gene ( 8 ); ATCC 3624, a cpe -negative type A isolate ( 10 ); NCTC8533, a cpe -lacking, type B isolate (provided by Richard Titball); CN5383, a cpe -negative type C isolate ( 10 ); PS52, a cpe -negative type D isolate (provided by Ronald Labbe); and 853, a type E isolate carrying silent cpe sequences ( 1 ).

Techniques: Southern Blot, Hybridization, Plasmid Preparation, Pulsed-Field Gel, Lambda DNA Preparation, Migration

Western Blot analysis of CPE expression by selected North American human GI disease isolates. The expression of CPE by sporulating cultures of control and disease isolates of C. perfringens was evaluated using a CPE-specific Western immunoblot procedure. Isolates were grown in sporulation media as described in the Materials and Methods and then sonicated. An aliquot (40 μl) of each sonicated sporulating culture lysate was then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by immunoblotting with CPE antibodies. The blot was developed for chemiluminescence detection to identify immunoreactive species. Results for control isolates shown include 10239 (NCTC10239, a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Results for representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. Molecular mass markers are shown at left; the arrow at right indicates the migration of purified CPE.

Journal:

Article Title: Genotyping of Enterotoxigenic Clostridium perfringens Fecal Isolates Associated with Antibiotic-Associated Diarrhea and Food Poisoning in North America

doi: 10.1128/JCM.39.3.883-888.2001

Figure Lengend Snippet: Western Blot analysis of CPE expression by selected North American human GI disease isolates. The expression of CPE by sporulating cultures of control and disease isolates of C. perfringens was evaluated using a CPE-specific Western immunoblot procedure. Isolates were grown in sporulation media as described in the Materials and Methods and then sonicated. An aliquot (40 μl) of each sonicated sporulating culture lysate was then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by immunoblotting with CPE antibodies. The blot was developed for chemiluminescence detection to identify immunoreactive species. Results for control isolates shown include 10239 (NCTC10239, a chromosomal cpe, food poisoning isolate) and F4969 (a plasmid cpe, non-food-borne human GI disease isolate). Results for representative North American human GI disease isolates shown include food poisoning isolates 537-5 and 538-1 and AAD isolates T34058 and W30554. Molecular mass markers are shown at left; the arrow at right indicates the migration of purified CPE.

Article Snippet: C. perfringens isolates used as controls in this study included F4969, a type A strain carrying the cpe gene on a plasmid ( 8 ); NCTC10239, a type A strain carrying a chromosomal cpe gene ( 8 ); ATCC 3624, a cpe -negative type A isolate ( 10 ); NCTC8533, a cpe -lacking, type B isolate (provided by Richard Titball); CN5383, a cpe -negative type C isolate ( 10 ); PS52, a cpe -negative type D isolate (provided by Ronald Labbe); and 853, a type E isolate carrying silent cpe sequences ( 1 ).

Techniques: Western Blot, Expressing, Sonication, Polyacrylamide Gel Electrophoresis, Plasmid Preparation, Migration, Purification